Flowers for Algernon Essay

If you were given the chance to triple your intelligence through surgery would you? In the story â€Å"Flowers for Algernon† by Daniel Keyes, is about a man named Charlie Gordon who has a low I.Q. and has a chance to triple it through surgery. He is a 37 year old man and is keeping a diary to see if he will be used for the surgery. In this book two doctors give Charlie a chance to triple his intelligence through surgery. Charlie should not get the surgery because nobody likes him, everyone feel sorry, and he eventually gets sick of being smart. Charlie should not have had the surgery because nobody likes him when he’s so smart. When he is smart no one can understand him. â€Å"Everybody seems frightened of me.† (232) At this time Charlie has had the surgery and he is so smart everyone is afraid of him. If he didn’t have this surgery everyone wouldn’t be frightened by Charlie. Because of this surgery Charlie lost his job. â€Å"They have driven me out of the factory.† (235) Here Charlie’s workers don’t want him at the factory anymore. Ever since he had the surgery bad things have happened. Nobody wants anything to do with Charlie. â€Å"People don’t talk to me or kid around like they used to.† (232) Charlie is now finding out that no one likes him when he’s smart just because they can’t understand him. Without the surgery he would still have friends. Since Charlie got the surgery it caused him to lose all the memory gained from the surgery. Because of the reason, he should not have had the surgery. Charlie has a job at the factory and â€Å"Everyone feels sorry for me at the factory.† (245) Without the surgery Charlie would not have lost his memory causing everyone to feel sorry. Charlie is finding that no one likes him and everyone feels bad. Charlie had an adult teacher Ms. Kinnian, since he lost his memory he went there and â€Å"She ran out of the room crying.† (243) This quote also shows everyones sorrow towards Charlie. During this quote Charlie lost his memory and went back to his old class. Charlie shouldn’t have had the surgery because everyone feels sorry for him and he lost all his friends. Without the surgery, he would never have lost his memory and friends. The final reason why he should not have had the surgery, because he eventually sick of being smart. He had a job that he liked and since he had the surgery he doesn’t want to be smart, so he quit his job. â€Å"I’ve quit my job at Domangans Plastic Box Company.† (234) This is showing Charlie becoming depressed. Without the operation Charlie would still be living happily and would never have quit his job. Charlie had the surgery because he wanted to become smarter, but now he feels differently. â€Å"I don’t want to be smart anymore† (243) When he had the surgery he had overcome his low I.Q., but he eventually became too smart and no one understood him. They thought he was odd, so nobody spoke to him. He became sick of being smart and wanted to not be smart. If he didn’t have the surgery he would have never wanted to not be smart. Charlie should never have had the surgery, because he gets sick of being smart, nobody cares for him, and everyone feels bad about him. The key points why he should not have had the surgery are, he lost his memory from the surgery, he quit his only job at the box company, plus nobody even understands him, he’s so smart. To conclude, these reasons clearly show why Charlie should not have had the surgery.

Human cloning and Immanuel Kant Essay

Over the last decade, the advent of cloning and advancements in human genetic research have presented society with a complicated moral quandary. Debate rages as to what constitutes legitimate paths of inquiry and where to draw the line as to research that strikes many people as morally wrong. The basic question is: â€Å"how does society determine what’s right? † While, of course, questions regarding human genetic research are new, this basic question is as hold as civilization and has been addressed over and over again by history’s great philosophers. One of the most notable philosophers of the modern era is Immanuel Kant, who was born in Prussia in 1724. Kant paid a great deal of attention to formulating a complex system of morality. The following examines Kantian morals and how they might be applied to questions of human genetic research. Kant’s moral theory is predicated on the idea of the â€Å"categorical imperative,† which Kant described in the following manner, â€Å"Act only on that maxim which you can at the same time will to be a universal law†(Honderich, 1995, p. 436). By the term â€Å"maxim,† Kant meant general rules or principles upon which rational individuals act, and that these principles reflect the end that an individual has in mind in choosing actions of a certain type in given circumstances (Honderich, 1995). Therefore, maxims are principles in the following form: â€Å"When in an S-type situation, act in an A-type manner in order to attain end- E† (Honderich, 1995, p. 436). For example, a person might resolve to pay a bill as soon as it is received in order to not incur any debt. Kant tested a maxim by performing a thought experiment in which the individual asks oneself whether or not one would will a certain maxim to become universal law. As this suggests, moral law, in the philosophy of Kant, is inherent in reason itself. It is a priori, before experience (Frost, 1962). In every circumstance, Kant believed that â€Å"categorical imperative† provides a sure criterion for how to evaluate right and wrong (Frost, 1962). Kant maintained that an action that the individual can easily will that everyone should follow and perform would necessarily have to be a good act (Frost, 1962). Morality for Kant not only involved law (categorical imperative) but also the ultimate end to which action is directed. As the formulation of the concept of categorical imperative suggests, the basic problem for Kant was to discern the meaning of â€Å"right and wrong, good and bad† (Frost, 1962, p. 94). Fundamental to Kant’s thinking was the principle formulated by Rousseau that the only fundamentally good thing in the universe is the â€Å"human will governed by respect for the moral law or the consciousness of duty† (Frost, 1962, p. 94). He considered a moral act to be one that is performed out of respect for moral law, rather than for selfish gain or sympathy for others (Frost, 1962). Therefore, unlike other moral systems, Kant did not see consequences as the criteria for determining the moral value of a specific action. Rather, Kant looked toward the intentions of the individual. If an individual acts from good intentions, out of respect for moral law, his actions, are by definition, â€Å"good. † Kant argued that individuals instinctively avoid behavior, which, if performed by everyone, would create anarchy. â€Å"We know, not by reasoning, but by vivid and immediate feelings, that we must avoid behavior which, if adopted by all men, would render social life impossible† (Durant, 1961, p. 209). As this brief summary of Kantian ethics suggests, if Kant were presented with the problem of the morality of genetic research, he would, first of all, be concerned about the motivations of the researchers, their intentions in conducting such research (Frost, 1962). In the furor that was quickly generated over the successfully cloning of a sheep, â€Å"Dolly,† the usefulness of cloning technology to current medical practice was pushed aside. Nevertheless, the applications are considerable. A great deal of technical information has been left out in the sensationalism that abounded in the media. For one thing, the media did not make it clear that â€Å"Dolly† was not an identical clone (Wilson,1997). Part of everyone’s genetic material comes from the mitochondria in the cytoplasm of the egg. In the case of Dolly, only the nuclear DNA was transferred (Wilson, 1997). This may have significant information to import to scientists concerning the aging process since aging is related to acquired mutations in mitochondrial DNA (Wilson, 1997, p. 913). Furthermore, as Dolly ages, it has been noted that she is aging prematurely, which provides another source of information for scientists, but also signals that this technology is far from perfected. Research conducted on nuclear transfer into human eggs has the possibility of providing an immense amount of information that may have clinical value, by providing a model for learning more about somatic cell differentiation (Wilson, 1997, p. 913). Eventually, in due course, scientists may learn how to influence cell differentiation and this could give rise to targeted cell types (Wilson, 1997). The ability to generate tissues from different cell types could have enormous implications for transplantation. Wilson (1997) anticipates this technology utilizing skin and blood cells, and possibly even neuronal tissue that could then be used in the treatment of â€Å"injury, transplants for leukemia, and for degenerative disease such as Parkinson’s disease† (p. 913). In another area of research, the successful cloning of human growth hormone (HGH) is important for several reasons. First of all, a child that has pituitary dwarfism requires twice-weekly injections until reaching age of 20. In the past, HGH was could only be obtained by removal of human pituitary tissue at autopsy. To treat one child with pituitary dwarfism using previous methods required obtaining over a thousand pituitaries (Emery and Malcolm, 1995, p. 165). Not only has it been difficult in the past to produce enough HGH to successfully provide treatment to all the children who needed it, but small amounts of contaminating virus caused some of the children treated to develop Creutzfeldt-Jacob disease (Emery and Malcolm, 1995, p. 165). Cloning technology, which permits HGH to be produced artificially, has provided a readily available supply of HGH, which-in turn-has allowed the application of HGH in other treatments. For example, it has been discovered that HGH can be used to speed up the healing process for bone fractures (Emery and Malcolm, 1995). This is been particularly beneficial in treating the elderly (Emery and Malcolm, 1995). As this brief summary of scientific research being conducted into cloning and genetic research indicates, there are enormous benefits to be reaped from this new and controversial technology. Kant would undoubtedly approve of research that so obvious benefits humanity and society. What people seem to fear, and what would undoubtedly be wrong by any moral system, are nightmare scenarios propagated by the media and Hollywood. Images of clones being used simply as â€Å"spare parts† to extend the life of the rich, for example, has been dramatized in film. This sort of misuse of technology would constitute a threat to the social system and, therefore, would not pass Kant’s categorical imperative test. In other words, if everyone were cloned, it would significantly lower the way that human life is valued in our society. Also, the idea of human embryos being created and destroyed simply to further genetic research objectives is simply abhorrent on an instinctive level. Therefore, while it! can be seen that this technology needs to be carefully controlled and supervised in regards to moral issues, it should not be totally banned either, as it also has the power to benefit society to a great degree.

Business overview of Southwest Airlines Company

Business overview of Southwest Airlines Company Southwest Airlines Company is an American low cost airline. Although the airline industry is no longer experiencing the rapid growth it exhibited during the 1990’s; commercial air travel in the U.S. remains the preferred method of transportation for a majority of Americans due to cost-effectiveness and timesaving characteristics. Southwest is the largest airline in the world by number of passengers carried per year (as of 2009). Southwest maintains the third largest passenger fleet among all of the world’s commercial airlines. As of May 3, 2009, Southwest operates approximately 3,510 flights daily. Southwest has its headquarters on the grounds of Love Field in Dallas, Texas. Southwest Airlines has carried more customers than any other U.S. airline since August 2006 for combined domestic and international passengers according to the U.S. Department of Transportation’s Bureau of Transportation Statistics. Southwest Airlines is one of the world’s most profit able airlines, posting a profit for the 37th consecutive year in January 2010. Southwest’s successful business model involves flying multiple short, quick trips into the secondary (more efficient and less costly) airports of major markets, and using only one aircraft type, the Boeing 737. Key Issues Southwest’s most visible problem, as with all airlines, is the drop in demand for air travel the past 18 months. While fallout from the terror attacks gets part of the blame, Kelly (Southwest CEO) says more of it goes to general economic weakness and specifically the collapse of the late ’90s technology and telecom bubble. Environmental changes are also having effects on the Industry. Budget conscious business travelers used to love Southwest, not only for its prices, but because it was so easy to buy a ticket at the last moment, move from curb to gate in minutes and be on their way. New security procedures have taken away this added convenience and have even lengthe ned the lines. Southwest operates on a first come, first serve basis and the random gate screenings, which tends to target last-minute, one-way flight passengers (a description of most of Southwest’s passengers) places fliers in the position to have to fly in the much dreaded middle seat. Analysis Models The analysis of Southwest will cover an external analysis, an internal analysis, and a SWOT analysis. External models utilized will be The Five Forces Model of Competition, Driving Forces, and Industry Key Success Factors. Internal models utilized will be a Financial Analysis, and a Competitive Strength Assessment or SWOT Analysis. The Five-Forces Model of Competition Rivalry among firms (High) The extent to which rivalry exists will influence the overall profitability of the industry. Market concentration remains a significant factor affecting rivalry. In 1989, no single airline solely dominated the industry, but the eight largest carriers retained a total market share of 92 high traffic cities with high demand. In order to gain profits, airlines must beat out the competition by offering as much or more flights with time flexibility to a variety of destinations. Other factors contributing to rivalry include high fixed costs, excess capacity, low differentiation, price wars, and readily available prices via the Internet. Due to the nature of the industry, high fixed costs are expected. Contributions to fixed costs in the airline industry include the costs of planes, fuel, pilots, flight attendants, and additional staff for baggage and customer service. The need to meet government regulations and hire experienced employees can cost an airline company millions of dollars. Currently there has been excess capacity on many routes; as a result, airlines have been participating in price wars in order to attract customers at all costs. Minimal differentiation among airlines and switching costs for passengers also magnifies rivalry.

Aviation Security Research Paper Example | Topics and Well Written Essays - 1500 words

Aviation Security - Research Paper Example This brings out the need to tighten the global security mostly within the airports that forms the target of terrorism attacks. This paper will focus in details on the issue of terrorism, its impact on aviation sector, and efforts that have been made to curb terrorism. According to the United States department of defense, terrorism is systematic use of prohibited violence, or threat of violence to instill fear, with the aim of coercing or intimidating government and societies in pursuing political, economic or ideological goals. It is a criminal act that usually influences an audience beyond the immediate victim. The terrorist, the victim and the public in general are the three perspective of terrorism. In most cases, he terrorist view themselves as not being evil but have the belief that they are combatants who are legitimate, fighting by whatever means at their disposal for what they believe in. On the other hand, the victim of a terrorism act views the terrorist as a criminal who has no regard for human life at all. The terrorist is meant to believe that in whatever he does he will get the backing of the general public for this cause (Adweek, 2003). Terrorism has been used in the past as a strategy by a number of people while other perpetrators consider it a holy war and thus obligated to take part in it. In spite of this a lot still has to be considered based on the different school of thought. When looked at critically, it is a weapon used by the stronger in the society to suppress the weaker ones. Terrorism uses power which is coercive in nature and military tactics are employed in terror acts. It is difficult to ascertain the magnitude of terror attacks because the attacker’s organization is not easy to understand and do something about it in short period of time (Adweek, 2003). That is the reason why such preemption

Essay about the biography of Leonardo da Vinci

About the biography of Leonardo da Vinci - Essay Example On the art front, there were great artists such as Michelangelo, artist and sculptor who was famous for his sculpting of â€Å"David† and the â€Å"Pieta’ and the frescos on the ceiling of God and man- Raphael, Botticelli, Titian and the unforgettable genius Leonardo da Vinci who has touched our lives in every possible aspect. Leonardo Da Vinci, (April 15th, 1452 – May 2nd 1519) was most famously known as the â€Å"Renaissance man† and the most gifted and multi- faceted person of his time or for that matter ever to have lived. Leonardo was most famous as a well renowned artist but besides this he was a scientist, inventor, botanist, painter, sculptor, engineer, writer and musician. In the words of da Vinci, â€Å"Iron rusts from disuse; stagnant water loses its purity and in cold weather becomes frozen; even so, does inaction sap the vigor of the mind†. (da Vinci Leonardo) – these words of Leonardo da Vinci throw light on this colossus of the Renaissance Age. Leonardo da Vinci embodies the virtues of this great epoch of history, which enriched humanity for ages to come. Leonardo was born out of wedlock to a wealthy Florentine notary and a peasant girl on April 15, 1452. His father, Piero da Vinci took the young boy under his wings and soon had him working as an apprentice under the great Florentine painter, Verocchio. Leonardo assisted him in painting â€Å"the Baptism of Christ† (1470) in which the angel kneeling on the left has been painted by him. After spending six years under the tutelage of Verocchio, Leonardo, in 1472, entered the painters’ guild in Florence and was soon being commissioned to work independently. Speaking on how to judge a painting, da Vinci was supposed to have quoted, â€Å"When you paint look at your work in a mirror; when you see it reversed, it will appear to you like some other painters work and you will be a better judge of its faults. (Leonardo da Vinci) This was the way he judged his works. In 1482, Leonardo moved to Milan

Supply Chain Management- Zara Essay Example | Topics and Well Written Essays - 2000 words

Supply Chain Management- Zara - Essay Example In such a drill, firms look forward into establishing a larger market share for its products and services. This is done by initiating Supply chains that are manageable with a manageable number of middlemen. Similarly, opening more production points in the market increases the aptness in supply of products in the market. Therefore, the best practice in approach in supply chain management is use of short supply chains, technological control and advancement, bulk transit of products, effective supply chain management, development of new production plants and investment in new markets. Introduction The core point in establishing a firm is to give a constant supply of goods, products and services. Therefore, a firm should strategise on making an effective and efficient supply of its products and services to the people that are in need. In many instances, firms that have apt supply strategies end up making a plausible outcome in their supply. For instance, a structure that ensures there is constant supply of the products attracts a larger demand due to its reliability. Though some factors could affect the supply of products and goods, a firm should ensure that it has a developed supply chain. With such a preparation, it is hard to disappoint the people that need these products by failing to give the goods they need. This shows that the most successful firms have to ensure they have an integrated supply strategy. This makes it appealing to the customers, which is reflected in the results that are recorded in any transaction calendar (Canzer, 2006:12). Following suit in such an approach is an entirely vital aspect that should be used by prospecting firms that need to succeed. Analysis and Discussion Supply chain management denotes the processes that are involved from the production of goods, products and services, through networks and the final relay of the products and services to the demands. It therefore closely involves procurement, manufacturing and distribution. In procurement, the manufacturing firm has to plan on all the materials that are required for production. They then have to acquire these materials and make them available. After this, the manufacturing process begins, where the stated products are produced. This is followed by distribution of the manufactured goods into the trade regions. However, the decision making has to involve logistics and global decision making. Therefore, this is a process that involves other minor processes, which involves many networks that are interconnected. The control of the supply of products does not depend on a single person, as it is at times complicated. As such, there is need to have apt control over the supply chain (Jordan, 2010:32). This will be a move to ensure the supply chain is giving adorable results. In many cases, the supply chain involves provision of packaged products and goods, movement of these goods and products from one place to another till the final consumption of the products and goods. Similarly, services have to pass through this chain to record a complete chain of supply (Zuckerman, 2002:23). Therefore, it is in the best interests of a firm to ensure the chain of supply is effective in delivering the services, products and goods to the demand. If this is not done, the firm will not be making an economic sense in producing the goods for the demand. While working in Zara, it is an admissible fact that the retailer has created the demand for its products. The retailer has been increasing

Verizon Communication Inc Essay Example | Topics and Well Written Essays - 500 words

Verizon Communication Inc - Essay Example (Plunkett 67) . On Feb 2005, Verizon approved to acquire MCI Company. The acquisition was to benefit it in terms of economics of scale and access to a wider base of customers. By the year 2006, MCI was already integrated into Verizon thus adopting the name verizon business. It then became the largest telecommunication company in the U.S In terms of its sales i.e. 75.11 billion; assets added up to 168.13 US dollars and the company had a profit of 9.4 billion US dollars. Later with the mergers of Bell South and AT and TINC, It became the largest telecommunications company based on its profits and assets in the world. (Plunkett 68) The company principarily operates in the US with its headquarters in New York. It offers wireless and wireline services such as voice, network access, data services, broadband video and global internet protocol networks.Verizon communications Inc Operates in more than 150 nations worldwide.Verizon voice messaging services is offered for both businesses and residences.Verizon’s Cell co partnership operates the second largest wireless telecomm network in the US In terms of the number of subscribers and revenue. It is also one of the major US carriers to utilize the CDMA technology and uses 8 billion US dollar annually in its maintenance and expansion. It offers both voice and 3G data services for example, text and picture messaging, over the air downloadable applications and wireless broadband based on EV-DO Rev A. It also carries various mobile services and phones eg LG, Motorola and Samsung. (Lutz 138) Verizon’s video services was launched in September , 2005 and uses optical fibre network to distribute more than 330 channels, 180 digital videos and music channels and 1800 video on demand titles. DSL internet services are offered to the same areas where phone services are provided. It is known to have the largest number of spammers of all networks globaly.Verizon’s yellow

Family Owned Business Essay Example | Topics and Well Written Essays - 1000 words

Family Owned Business - Essay Example This business enterprise has strived to accept the services of professionals in attaining a competitive edge over its rivals. In fact, it has adjusted to change and have embraced the new technologies to attain growth. Also, it believes in diversity in manpower as it helps in garnering the best talents in the market. Hence, a diverse manpower also gives this family owned business the path to flourish and excel and attain further growth. It believes in diversifying business so that the firm has greater stability in business. Moreover, this is one group which undertakes long-term planning and has formed strategic partnerships and diversified the group to include expert services into different segments of the market. This helps them to have a wider customer base. By conducting the above study on family businesses, we have observed that such business enterprises thrive in the market mainly due to the dedication and commitment displayed by members of the family. Also, these people are focu sed towards the growth of the organization as the adverse reputation of the firm may negatively hamper the reputation of the family name. Moreover, these enterprises are chiefly controlled by family members or maybe family owned. However, they may form strategic partnerships wherein family members hold key positions in the management of the company. Lastly, the key to success in such firms is by gaining a competitive edge, valuing organizational culture and allowing a diverse workforce in order to benefit from diversity.

Three branches of the U.S. government Essay Example | Topics and Well Written Essays - 1000 words

Three branches of the U.S. government - Essay Example The U.S. government has three branches: the legislative, the executive, and the judiciary, each performing independently various function that support the functioning of the government. The three branches work independently.Consequently, the singular purpose of having the three branches working separately is to promise that they do not become too powerful to infringe on the freedoms of the population. In analyzing the three branches of the government, we see that all of their functions serve the public differently, and some branches seem to have more power than others in affecting the work of the government. Hence, this essay discusses the legislature because it has done and is doing a lot for the people of the United State (Trueman, 2000). The legislature is comprised of the bicameral Congress, the Senate, and the House of Representatives. The two houses are tasked with many functions, but their main purpose is to make legislative laws. The Senate is the upper house with each state represented by two senators in it. The House of Representatives represents the lower house and has a number of elected members proportionate to the population of a state. The Senate has one hundred seats and allows elected members to serve for a six-year term. However, the House of Representatives has a bigger number of members, and currently there are 435 members serving for a two-year term. The House of Representatives and the Senate have almost similar functions, but they also have specific responsibilities and powers. In addition, the two chambers work parallelly to each other in passing the bills that originate from either the Senate or the House of Representative (Wilson, Dilulio, & Bose, 2009). The legislative branch has many functions, but law making is its key function. The executive branch implements and enforces the law, whereas the judiciary branch interprets them. Hence, in serving the people, the legislative branch has the most power given that it is the one that delib erates on the bill that later becomes a law. The input of bills in addressing the challenges people encounter in their daily activities acknowledges the work of the Congress for the benefit of the Americans. Therefore, their service to the people supersedes the enforcing and elucidation of the executive and the judiciary branches. Furthermore, the legislative branch consists of elected members, and thus it represents the heart of representative democracy. When the law makers make laws, they do so in a democratic manner to meet the public interests and to ensure they are upheld (Wilson et al., 2009). In addition to making laws, the legislature has other non-legislative powers and responsibilities. These functions are not in any way related to the legislation of laws. One of the non-legislation powers of the Congress are the electoral powers. The electoral powers are only exercised when the electoral process fails to determine the results of a presidential election. The House of Repre sentatives is privileged to elect the president in cases where no candidate gains a majority Electoral College. On the other hand, the Senate is responsible for electing vice president in case no presidential candidate has enough Electoral College to ensure the victory of his nominee to the position of a vice president (Wilson et al., 2009). The legislative branch also has the non-legislative power of impeachment. The House of Representatives has the power to impeach federal government officials who are deemed to have bribed, committed high crimes, misdemeanors, and treason. While the House has the powers to impeach, the Senate acts as the judge and jury. In the history of the United States, only two presidents have been impeach: Bill Clinton (1998) and Andrew Johnson (1868), who both were acquitted by the Senate. Another non-legislative function of the Congress is the power of confirmation. The senate has the

Final Project Essay Example | Topics and Well Written Essays - 1250 words

Final Project - Essay Example Many Americans feel this reluctance stems from an unwillingness to reveal something that they do not want consumers to know. The best solution is to require mandatory labeling of all of the products that are considered GMO, genetically engineered, or in any way augmented in or by a laboratory. Genetic research has been going on for several decades and is still going strong. Most people hear the words genetic engineering or biotechnology they think of science fiction stories. However, real, modern biotechnology is quite different and it is certainly not science fiction. The manifestation of biotechnology is not so much â€Å"in your face,† as it is â€Å"in your food.† In fact, for more than a decade the majority of processed foods in the United States include ingredients containing genetic material derived from plants whose DNA has undergone laboratory manipulation. The most common genetically altered crops in the United States include soybeans, corn, cotton, and canola . The soybeans carry DNA derived from bacteria that cause the plants to be resistant to common weed killing pesticides, as well as, corn crops, which, also, is taken from DNA from bacteria, which allow the corn to produce its own natural pesticide.(Harmon & Pollack, 2012) It has been determined that most store bought products contain some form of soy or corn, including high fructose corn syrup, and exist in 60-70% of the foods on the grocery store shelves, including cereals, snack foods, dressings/dips, crackers, and chips are all the products of genetic modification, in one way or another.(Byrne, 2013) Supporters of mandatory labeling believe that they manufacturers do not want labeling because they do not want consumers to be aware of how much GMO food they are already consuming. They, also, feel that the scientists, biotechnological farms, and the big businesses that profit from them do not want to be forced to label such products. In their eyes they are putting profit before pub lic awareness and, potentially, public safety. This public concern is not strictly an American phenomenon. Consumers prefer to be informed. Twenty-one countries have already implemented mandatory labeling requirements; so one might ask, why should the United States be any different? (Byrne, 2013) Consumers have a right to know through clearly marked packaging, to make informed choices about the ingredients being mentioned, and understand what exactly they put into their bodies. The claim that GMO goods are completely and thoroughly safe, however, is not something that any of the scientists today can actually guarantee. They can only confirm that there appears to be no danger or side effects associated with consuming GMO foods or food ingredients. It has never been confirmed through human testing that that is true, especially over a period of long term consumption. That said, they are essentially asking us to take their word for it without providing much in the way of facts and detai ls. In fact, biotechnologists today are, basically, using the same limited

Points Understanding Human Behavior is critical to organizations Essay Example for Free

Points Understanding Human Behavior is critical to organizations Essay Understanding human behavior is critical to organizations. An organization can be defined as a collection of people who work together to achieve a goal or a variety of goals. These people do not work on isolation within the organization. They interact with each other and with third parties (suppliers, customers, competitors, government officials, etc.) in a variety of ways. Therefore, a leader who understands how and why people behave the way they do, he can identify problems, determine the best ways to correct them and establish whether the changes would make a difference towards improvement. Prior to understanding other peoples’ behavior or attempting to influence others’ behavior, a leader must be able to perform a self-assessment in order to understand and subsequently manage his emotions. Unless leaders understand the criticality of human behavior to the organization and the need for self-evaluation/self-assessment, their efforts to influence others will never be achieved. As introduced by Goleman (Daniel Goleman, 2000), the ability to recognize, then to understand and finally to manage your emotions is called â€Å"Emotional Quotient† (EQ). Coleman asserted that a high EQ had a positive impact on one’s relationship. The better you are at understanding your own emotions, the more likely you are to be adept at picking up on the feelings of others. Knowing how others feel can be a valuable skill within organizational interactions (meetings, presentations, day-day cooperation, etc.) and beneficial to the organization. For example, during a meeting a CEO is furious about an issue and he shows it by shouting, the rest of the participants may hesitate to express their ideas or thoughts. On the other hand if the CEO identifies and controls his emotional situation and understands that his anger if expressed will cause the rest of the participants to become reluctant on expressing themselves, a fruitful conversation may go on and ideas on how to overcome the issue may arise. On an interpersonal level, self-awareness can net you the trust of others and increase your credibility, both of which will increase your leadership effectiveness. On an organizational level, the benefits are even greater. When you acknowledge your emotional status and you manage your reactions youre modeling that in your organization even negative  experiences are dealt with calmness on purely professional way that leads to corrective actions. These are all characteristics of an organization that is constantly learning and springboards to innovation and agility two hallmarks of high performing organizations. As claimed by Goleman (Daniel Goleman, 2000) leaders use six leadership styles (coercive, authoritative, affiliate, democratic, pacesetting and coaching), each springing from different components of emotional quotient. Only four of these styles have a positive effect on climate and results. As concluded by Coleman (Daniel Goleman, 2000), leaders need to implement many styles depending on the situation they have to deal with. How would a leader be able to intentionally apply a specific style? Different situations require different leadership styles. A leader who is characterized by self-awareness is able to identify his emotional status, manage his emotions and perform under a different, more beneficial, leadership style.

Psych Unit IV Article Review Essay Example for Free

Psych Unit IV Article Review Essay There are so many different theories out there that try to explain why we act the way we act. How do we explain evil or hateful behavior? I just finished reading the article ‘’Prison Violence: Does brutality come with a badge?’’, written by: Bruce Gross. This article talks about being a prison guard, and how some people act when they enter this career. Would you act differently if you went from the role of the prisoner to the role of the prison guard? There have been many reports of ‘’cruel and unusual’’ punishment that is being administered by prison guards to inmates in prisons. Not only are inmates reporting this abuse, but federal authorities are also recognizing there is a problem. In 2005, the commission on Safety and Abuse in Prisons said there were 16,000 allegations of sexual and physical assault that were reported. There are also reports of abuse happening in County jails as well as in prisons. ‘’Inmates have reported being choked, kicked, punched, and hit with objects by single or multiple guards’’, (Gross, 2008). If you look back at our history, it is full of ordinary people who commit terrible acts of violence. Some people have done studies and are trying to understand why people commit these ‘’evil crimes’’. Stanley Milgram is one of those people. He was a Yale University professor, who conducted an experiment in 1961. In this experiment there were ‘’teachers’’ and there were ‘’learners. The teachers were given the power to administer a shock to the learners if they answered a question wrong. It was surprising how much the ‘’teachers’’ in the experiment would shock the ‘’learners’’ and the amount of volts that they would use without protest. Another experiment that was done to test these violent behaviors was known as the Stanford Prison Experiment. In August of 1971, this experiment was started by psychology professor Philip Zimbardo. He put an ad in the paper and found volunteers to play role of ‘’prisoner’’ and the role of ‘’guard’’. He created a prison-like environment in the basement of the psychology building on the Stanford Campus. There was some definite brutality that started to show in the guards during this experiment. Some showed more than others. After only 6 days, the experiment was shut down. One third (1/3) of these ‘’guards’’ showed sadistic behavior. There was a similar study done that was called the BBC Prison Study. This study was also shut down early. ‘’Both of these prison studies demonstrated that under some circumstances, some individuals resist going-with-the flow of group associated brutality’’, (Gross, 2008). Sometimes an individual will behave differently if they know they’re being watched. In the SPE experiment, the participants knew they were being watched by ‘’supervisors’’, and on the BBC experiment, they knew they were being watched by an audience (including family and friends). These factors may have affected the way that either group acted throughout the experiment. I know I would act differently if I knew that my mother was watching me. Some people think it’s the environment that people are in that brings out violence. Well of course it is! If you treat someone like a caged animal, eventually they will start acting like one. If a guard is told to dehumanize a prisoner, then you will probably see violence out of the guards, as well as out of the prisoners. ‘’Violence and extreme behaviors by guards against inmates have many sources’’, (Gross, 2008). In the prison studies that were covered in this article, it didn’t surprise the experimenters that ‘’good people’’ were committing evil acts when they played the role of the guards. They were more surprised and shocked that more people didn’t stand up for what was right. Even if they didn’t agree with what was happening, they just kept their mouth shut, and went with the flow. At the end of the article, Gross says, ‘’Perhaps the adage is true, that real evil exists and flourishe s when good people do nothing’’.

Genetic Diversity and QoI Fungicide Resistance

Genetic Diversity and QoI Fungicide Resistance Study of genetic diversity and QoI fungicide resistance in frogeye leaf spot (Cercospora sojina) from Tennessee Introduction Frogeye leaf spot (FLS) of soybean (Glycine max Merr.), caused by the fungal pathogen C. sojina Hara, was first identified in Japan in 1915 and South Carolina, the United States in 1924 (Lehman 1928; Phillips 1999). FLS is an important foliar disease of soybean although symptoms can appear on stems, pods, and seeds. There has been no report of the alternative host in other crops or weeds (Mian et al. 2008). Initial symptom appears as small, light brown circular spot which is later surrounded by darkish brown to reddish circle. (Dashiell and Akem 1991). As the leaves are covered with 50% lesions, leaves start to blight wither and finally falls prematurely. On the lower surface of leaves, the central spot of lesions is somewhat grayish because of conidia produced on conidiophores. Conidia are a primary and secondary source of inoculum and are produced in infected leaves, stems, and pods. Warm temperature and frequent rainfall are suitable factors for severe disease, and fully expanded leaves are more resistant with small lesions as compared to younger leaves (Phillips 1999). The United States is the leading producer of soybean in the world. According to the food and agriculture organization (FAO), the US produced 108 million metric tons of soybeans, second only to corn in 2014 (http://faostat3.fao.org/). FLS is an important disease in most of the soybean growing countries in the world and the main factors hindering the yield includes a reduction in photosynthetic area and premature defoliation of leaves (Mian et al. 2008; Wrather et al. 2010). In the US, FLS is significantly present in Southern warm and humid regions (Mian et al. 2008; Yang et al. 2001). Now, C. sojina is also important to Northern states as the disease was reported in Iowa in 1999, Wisconsin in 2000 (Mengistu et al. 2002) and Ohio in 2006 (Cruz and Dorrance 2009). The damage caused by FLS depends on soybean cultivars and locations, and yield loss has been reported from 10% to more than 60% (Dashiell and Akem 1991; Hartwig and Edwards Jr 1990; Laviolette et al. 1970; Mian et al. 1998). FLS is a polycyclic disease and the disease remains active throughout the growing season (Kim et al. 2013; Laviolette et al. 1970). Dispersal of conidia to some distance is favored by the wind and water splashes (Laviolette et al. 1970). Mycelium of C. sojina can overwinter and a report suggests potential survival of the pathogen in the plant debris for two years (Zhang and Bradley 2014). There are several FLS control methods including cultural practices, use of fungicides and genetic resistance. Primarily, genetic resistance is a most effective measure to control FLS. Till now, three resistant genes Rcs (Resistant to C. sojina), have been deployed: Rcs1 (Athow and Probst 1952), Rcs2 (Athow et al. 1962) and Rcs3 (Phillips and Boerma 1982). The Rcs3 gene confers resistant against race 5 and all known races of C. sojina present in the USA. (Mengistu et al. 2012; Phillips and Boerma 1982). Similarly, crop rotation for two years has been suggested to skip viable inoculum and prevent dise ase severity in the field (Grau et al. 2004; Zhang and Bradley 2014). Further, use of pathogen-free seeds and necessary application of fungicides before flowering to early pod stage have been practiced to decrease disease severity (Grau et al. 2004). Meanwhile, because of change in the pathogen, it has been proven that resistant gene can confer resistance for a certain period and there can be selection against QoI fungicides too (Athow and Probst 1952; Athow et al. 1962; Zeng et al. 2015). There has already been a report of field isolates resistant to QoI fungicides in Tennessee (Zhang et al. 2012). Control measures like use of fungicides and planting of resistant cultivars force pathogens to select against selection pressure. Studies of C. sojina using several approaches indicate diversity among isolates. Because of the lack of universally accepted soybean differentials, its hard to characterize and compare C. sojina isolates. Grau et. al. (2004) have reported 12 races of C. sojina in the US, 22 races in Brazil and 14 races in China. A new set of 12 soybean differentials and 11 races have been proposed based on the reaction of isolates collected from the USA, Brazil, and China (Mian et al. 2008). However, the reaction of 50 isolates from Ohio on the same 12 soybean differentials produced 20 different races (Cruz and Dorrance 2009). There has been a handful of research to characterize C. sojina based on molecular markers. One study includes AFLP based assessment of 62 isolates from Brazil, China, Nigeria and the United States, which showed a significant amount of genetic diversity among isolates, although genotypes did not cluster based on origin. (Bradley et al. 2012). Recently, a study of 132 isolates fr om Arkansas with simple sequence repeat (SSR) has shown the chances of sexual reproduction and high genetic diversity in C. sojina (Kim et al. 2013). The main objectives of this study were to access: genetic diversity by developing and using novel SNP markers and distribution of QoI resistant and sensitive isolates from Jackson and Milan, TN. Sample collection, Single-lesion Isolation, and DNA extraction In 2015, soybean leaves exhibiting typical symptoms of infection with FLS were collected from research plots at two locations in Tennessee (Milan and Jackson). In total, 437 isolates, 203 from Jackson and 234 from Milan, were collected from eight fungicides treated and non-treated Maturity group III soybean cultivars (Table 1). Cultivars were planted in 4 rows (30-inch row spacing), 30 ft long plots in a randomized complete block design with four replications. Plots were split, two rows were not treated, and two rows were treated at R3 growth stage (beginning pod) with Quadris Top SB at 8 fl oz/a (Azoxystrobin and Difenoconazole, Syngenta Corp., Basel, Switzerland). A single isolate of C. sojina was obtained from a single lesion from each leaf. Sporulation was induced by incubating leaves in a plastic bag with moist towels at room temperature. Spores were harvested with a flame-sterilized needle using a dissecting microscope and 8-10 spores transferred to RA-V8 agar media (rifampicin 25 ppm, ampicillin 100 ppm, 160 mL unfiltered V8 juice, 3 gm calcium carbonate and 840 mL water). Observations were made daily and contaminated sectors removed. After seven days, single-lesion isolates of C. sojina were transferred to a new V8 agar media. In addition, a set of 40 isolates from 10 different states, collected before 2015, were included in this study (Table 2). Table 1. Soybean cultivars and number of Cercospora sojina isolates recovered from treated and non-treated cultivars. Cultivar ID Cultivars Jackson Milan Total Treated Non-treated Treated Non-treated C1 VAR Armor 37-R33 RR2 17 11 21 4 53 C2 VAR Asgrow AG3832 GENRR2Y 7 15 20 14 56 C3 VAR Becks 393R4 0 0 0 3 3 C4 VAR Croplan R2C 3984 19 13 11 14 57 C5 VAR Mycogen 5N393R2 RR2 g 12 20 17 28 77 C6 VAR Terral REV 39A35 10 15 13 16 54 C7 VAR USG 73P93R 22 6 13 21 62 C8 VAR Warren Seed 3780 R2Y It 14 22 13 26 75 Table 2. Number of Cercospora sojina isolates collected from Jackson (JTN) and Milan (MTN), Tennessee in 2015 and historical isolates from various states in previous years. Location No. of Samples Year JTN 203 2015 MTN 234 2015 AL 5 2006 AR 5 2006 FL 1 2006 GA 4 2006 IA 1 2006 IL 2 2006/09 LA 1 2006 MS 6 2006 SC 2 2006/2009 TN 12 2007 WI 1 2006 Note: JTN (Jackson) and MTN (Milan) collection in 2015 in Tennessee. TN is a historical collection. For DNA extraction, the single-lesion isolates were grown in 24-well deep well plates (Fisher Scientific) with 1 mL RA-V8 liquid broth (same as above, minus the agar) per well. DNA was extracted as described by Lamour and Finley (2006). Briefly, this includes harvesting mycelium from the broth cultures into a 96-well 2 mL deep well plate pre-loaded with 3-5 sterilized 3 mm glass beads. The plates are freeze dried and the dried mycelium powdered using a Mixer-Mill bead beating device (Qiagen). The powdered mycelium was then lysed and a standard glass fiber spin-column DNA extraction completed. The resulting genomic DNA was visualized on a 1% gel and quantified using a Qubit device. SNP marker discovery and targeted-sequencing based genotyping Whole genome sequencing was accomplished for three FLS isolates from a historical collection originally compiled by Dr. Dan Philips, UGA: FLS11 (CS10117) recovered from Milan, Tennessee in 2010, FLS19 (TN10) from the Georgia Experiment Station, and FLS21 (TN85) which was recovered from Mississippi. Genomic DNA was extracted from freeze-dried and powdered mycelium using a standard phenol-chloroform approach and the resulting DNA was submitted to the Beijing Genomics Institute in China for 2100 paired-end sequencing on an Illumina HiSeq2000 device. De novo assembly, read mapping and SNP discovery was accomplished with CLC Genomics Workbench 7 (Qiagen). As there was no public reference genome available at the time, FLS21 was de novo assembled using the default settings in CLC and the resulting contigs used as a reference genome. All open reading frames (ORFs) longer than 300 amino acids were predicted using CLC and annotated onto the FLS21 contigs. The raw reads from FLS11 and FLS19 wer e then mapped to the draft reference (separately), and putative single nucleotide variants (SNVs) identified at sites with at least 20X coverage and an alternate allele frequency greater than 90%. A subset of the SNVs was chosen from the largest contigs for further genotyping using a targeted sequencing approach. Custom Perl scripts were used to extract the flanking sequences for the panel of SNPs and primers were designed using BatchPrimer3 v1.0 (http://probes.pw.usda.gov/batchprimer3/) to amplify targets between 80 and 120bp in length. Primers for 50 SNPs including mitochondrial QoI resistant locus are summarized in Table 3. Primer sequences and genomic DNA were sent to Floodlight Genomics (Knoxville, TN) for processing as part of a non-profit Educational and Research Outreach Program (EROP) that provides targeted-sequencing services at cost for academic researchers. Floodlight Genomics uses an optimized Hi-Plex approach to amplify targets in multiplex PCR reactions and then sequences the resulting sample-specific amplicons on either an Illumina or Ion NGS device. Resulting sample-specific sequences were mapped to the reference contigs and genotypes assigned for loci with at least 6X coverage. QoI resistant locus genotyping A single nucleotide polymorphism (G/C) in the Cytochrome b gene of the C. sojina mitochondrial genome has been shown to confer resistance to QoI fungicides. A custom TaqMan SNP genotyping assay will be designed using the online design tools from Applied Biosystems (Thermo Scientific) and include the forward primer GGGTTATGTTTTACCTTACGGACAAATG and reverse primer GTCCTACTCATGGTATTGCACTCA and two probes to discriminate resistant and sensitive isolates: ACTGTGGCAGCTCATAA with VIC for the C resistance allele and ACTGTGGCACCTCATAA with FAM for the G sensitive allele (Zeng et al. 2015). Quantitative PCR (qPCR) will be accomplished based on manufacturer instruction using the QuantStudio 6 Flex Real-time PCR System (Thermo Fisher Scientific Inc.). Mating types determination A previously described multiplex PCR assay will be used to assign mating type (MAT1-1-1 or MAT1-2) to a subset of the isolates that had unique multi-locus SNP genotypes (Kim et al. 2013). The MAT1-1-1 locus will be amplified with CsMat1f (5 TGAGGACATGGCCACCCAAATA) and CsMat1r (5 AAGAGCCCTGTCAAGTGTCAGT) and the Mat1-2 locus will be amplified with CsMat2f (5 TGTTGTAGAGCTCGTTGTTCGCA) and CsMat2r (5 TCAGACCTTATGAGCTTGAAAGTGCT) primers (Kim et al. 2013). The assay will be included with the ITS5 (5 GGAAGTAAAAGTCGTAACAAGG) and ITS4 (5 TCCTCCGCTTATTGATATGC ) primers as an internal control to amplify the internal transcribed spacer (ITS) region (White et al. 1990). The resulting PCR products will be visualized under UV light on 2% agarose gel stained with GelRed (Phenix Research Products) and scored based on fragment size of MAT1-1-1 (405 bp) and Mat1-2 (358 bp). Data Analysis SNP loci for each sample will be combined to form a multi-locus SNP genotypes and samples with identical genotype (clonal lineages) will be clone corrected. To assess population structure among the two locations (and in relation to the historical isolates), Bayesian clustering will be accomplished using Structure 2.3.4 (Pritchard et al. 2000). Structure Harvester (Earl 2012) will be used to find the most probable value of K from the results obtained from Structure analysis. Principle coordinate analysis, AMOVA, Nei pairwise genetic distance, Nei pairwise genetic identity and genetic indices will be analyzed with GENALEX (Peakall and Smouse 2006). Phylogenetic clustering of the unique genotypes will be accomplished using Mega 6.06 (Tamura et al. 2013). Minimum spanning networks (Bandelt et al. 1999) will be constructed with PopART (http://popart.otago.ac.nz/). Expected Results Novel SNP markers will be developed and assayed in C. sojina isolates. Population study will help to determine if the isolates from two locations are sub-grouped. The genetic study will also accesses genetic diversity present within and among populations. Molecular identification of mutated cytochrome b site will help to determine the distribution of resistant isolates and contribute to compare resistant isolates in fields between two different time periods. Study of two different mating types in population will help to predict sexual reproduction. References Athow K and Probst AH. 1952. The inheritance of resistance to frog-eye leaf spot of Soybeans. Phytopathology 42(12):660-662 pp. Athow KL, Probst AH, Kurtzman CP and Laviolette FA. 1962. A newly identified physiological race of Cercospora sojina on soybean. Phytopathology 52(7):712-714 pp. Bandelt H-J, Forster P and RÃ ¶hl A. 1999. Median-joining networks for inferring intraspecific phylogenies. Molecular biology and evolution 16(1):37-48. Bradley C, Wood A, Zhang G, Murray J, Phillips D and Ming R. 2012. Genetic diversity of Cercospora sojina revealed by amplified fragment length polymorphism markers. Canadian Journal of Plant Pathology 34(3):410-416. Cruz C and Dorrance A. 2009. Characterization and survival of Cercospora sojina in Ohio. Plant Health Progress doi 10. Dashiell K and Akem C. 1991. Yield losses in soybeans from frogeye leaf spot caused by Cercospora sojina. Crop Protection 10(6):465-468. Earl DA. 2012. STRUCTURE HARVESTER: a website and program for visualizing STRUCTURE output and implementing the Evanno method. Conservation genetics resources 4(2):359-361. Grau CR, Dorrance AE, Bond J and Russin JS. 2004. Fungal diseases. Soybeans: Improvement, production, and uses(soybeansimprove):679-763. Hartwig E and Edwards Jr C. 1990. The uniform soybean tests, southern region, 1989. USDA Mimeographed Rep. US Gov. Print. Office, Washington, DC. Kim H, Newell AD, Cota-Sieckmeyer RG, Rupe JC, Fakhoury AM and Bluhm BH. 2013. Mating-type distribution and genetic diversity of Cercospora sojina populations on soybean from Arkansas: Evidence for potential sexual reproduction. Phytopathology 103(10):1045-1051. Laviolette F, Athow K, Probst A, Wilcox J and Abney T. 1970. Effect of bacterial pustule and frogeye leafspot on yield of Clark soybean. Crop science 10(4):418-419. Lehman S. 1928. Frog-eye leaf spot of Soy Bean caused by Cerco-spora diazu Miara. Journal of Agricultural Research 36(9):811-833. Mengistu A, Bond J, Mian R, Nelson R, Shannon G and Wrather A. 2012. Resistance to Frogeye Leaf Spot in selected soybean accessions in MG I through MG VI. Plant Health Progress 10. Mengistu A, Kurtzweil NC and Grau CR. 2002. First report of Frogeye Leaf Spot (Cercospora sojina) in Wisconsin. Plant Disease 86(11):1272-1272. Mian M, Boerma H, Phillips D, Kenty M, Shannon G, Shipe E, Blount AS and Weaver D. 1998. Performance of frogeye leaf spot-resistant and-susceptible near-isolines of soybean. Plant disease 82(9):1017-1021. Mian M, Missaoui A, Walker D, Phillips D and Boerma H. 2008. Frogeye Leaf Spot of Soybean: A review and proposed race designations for isolates of Hara. Crop science 48(1):14-24. Peakall R and Smouse PE. 2006. GENALEX 6: genetic analysis in Excel. Population genetic software for teaching and research. Molecular ecology notes 6(1):288-295. Phillips D. 1999. Frogeye leaf spot. Compendium of soybean diseases, 4th ed. American Phytopathological Society Press, St. Paul, MN:20-21. Phillips D and Boerma H. 1982. Two genes for resistance to race 5 of Cercospora sojina in soybeans. Phytopathology 72(7):764-766. Pritchard JK, Stephens M and Donnelly P. 2000. Inference of population structure using multilocus genotype data. Genetics 155(2):945-959. Tamura K, Stecher G, Peterson D, Filipski A and Kumar S. 2013. MEGA6: molecular evolutionary genetics analysis version 6.0. Molecular biology and evolution:mst197. White TJ, Bruns T, Lee S and Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR protocols: a guide to methods and applications 18(1):315-322. Wrather A, Shannon G, Balardin R, Carregal L, Escobar R, Gupta G, Ma Z, Morel W, Ploper D and Tenuta A. 2010. Effect of diseases on soybean yield in the top eight producing countries in 2006. Plant Health Progress doi 10:2008-2013. Yang X, Uphoff M and Sanogo S. 2001. Outbreaks of soybean frogeye leaf spot in Iowa. Plant Disease 85(4):443-443. Zeng F, Arnao E, Zhang G, Olaya G, Wullschleger J, Sierotzki H, Ming R, Bluhm B, Bond J and Fakhoury A. 2015. Characterization of quinone outside inhibitor fungicide resistance in Cercospora sojina and development of diagnostic tools for its identification. Plant Disease 99(4):544-550. Zhang G and Bradley CA. 2014. Survival of Cercospora sojina on soybean leaf debris in Illinois. Plant Health Prog 10. Zhang G, Newman M and Bradley C. 2012. First report of the soybean frogeye leaf spot fungus (Cercospora sojina) resistant to quinone outside inhibitor fungicides in North America. Plant Disease 96(5):767-767.

How to Perform Rhetorical Analysis :: Rhetorical Analysis Essays

How to Perform Rhetorical Analysis Becoming a critical reader means learning to recognize audiences, writers, points of view and purposes, and to evaluate arguments. In addition to the rhetorical triangle, structure of an argument, and rhetorical appeals, you should look at the following devices used by authors when performing critical analysis. Keep in mind too that these are only some of the devices, and that authors may use other rhetorical devices as well. Word choice Denotative language. Words that relate directly to the knowledge and experience of the audience. Includes specialized, precise or familiar words that speak to logic. Specialized terminology from medicine or law speaks to doctors or lawyers. Precise language that shuns emotional coloration appeals to people who use logic and reason, regardless of profession. Connotative language: Words that relate to deeper, symbolic levels of meaning. It includes social meanings acquired through use and emotional associations. It can also reflect social, racial, political, or religious stereotypes. For example, a writer who refers to liberals as â€Å"bleeding hearts† communicates not only her or his own bias, but an expectation that the audience shares this bias. Tone: can be characterized as the author’s attitude toward the reader or toward the topic. Formal: Creates a distance between the writer and audience by removing most I’s and you’s, and by using elevated, specialized language. Formal tone suggests a serious, high-minded, probably well-educated audience. Informal: Introduces the personal. When a writer is informal, the kinds of stories she relates, the way she presents herself, even the words she uses suggest audience attributes by indicating what she expects them to accept. Irony: Points to discrepancies between what exists and what ought to be. It is a subtle tactic that assumes an audience of careful readers. It implies some sort of discrepancy or incongruity, and it counts on the readers’ ability to understand this discrepancy. Sarcasm: Also points to discrepancies between what exists and what ought to be. A writer using sarcasm often attacks an argument by saying the opposite of what he means. Humor: Tactic that plays on social group bias. When we laugh at something, we join with people who are of like minds to laugh at the other—the distorted, the unusual, or the exaggerated. Point of View Objective: the writer seems removed from what she writes about. Objective writing uses concrete, unemotional words that relate facts, events, and data. It leads readers to action by appealing to logos and ethos.

Lord of the Flies :: essays papers

Lord of the Flies Children all over the world hold many of the same characteristics. Most children are good at heart, but at times seem like little mischievous devils. Children enjoy having fun and causing trouble but under some supervision can be obedient little boys an d girls. Everybody, at one time in their lives, was a child and knows what it is like to have no worries at all. Children have their own interests and react to different things in peculiar and sometimes strange ways. For example, children are enchanted with Barney and his jolly, friendly appearance without realizing that he is actually a huge dinosaur. In the novel The Lord of the Flies, by William Golding, one can see how children react to certain situations. Children, when given the opportunity, wo uld choose to play and have fun rather than to do boring, hard work. Also, when children have no other adults to look up to they turn to other children for leadership. Finally, children stray towards savagery when they are w! ithout adult authority. Therefore, Golding succeeds in effectively portraying the interests and attitudes of young children in this novel. When children are given the opportunity, they would rather envelop themselves in pleasure and play than in the stresses of work. The boys show enmity towards building the shelters, even though this work is important, to engage in trivial activities. Af ter one of the shelters collapses while only Simon and Ralph are building it, Ralph clamours, "All day I've been working with Simon. No one else. They're off bathing or eating, or playing." (55). Ralph and Simon, though only children, are more mature a nd adult like and stray to work on the shelters, while the other children aimlessly run off and play. The other boys avidly choose to play, eat, etc. than to continue to work with Ralph which is very boring and uninteresting. The boys act typically of m ost children their age by being more interested in having fun than working. Secondly, all the boys leave Ralph's hard-working group to join Jack's group who just want to have fun. The day after the death of Simon when Piggy ! and Ralph are bathing, Piggy points beyond the platform and says, "That's where they're gone. Jack's party. Just for some meat. And for hunting and for pretending to be a tribe and putting on war-paint."(163). Piggy realizes exactly why the boys have gone to Jack's, which would be for fun and

Cayman Islands History :: Historical Cayman Island Essays

Cayman Islands History Over the last five hundred years the Cayman Islands have had a rich and diverse history. They grew from being very isolated islands inhabited mostly by crocodiles and turtles to being one of the worlds premier tourist and financial centers. Being so small and isolated has given the Caymanians a strong sense of history and culture that is distinct, even from their Caribbean neighbors. They enjoyed a relative sense of insulation from many of the problems that plagued the rest of the region. The Caymans were â€Å"discovered† by the west by Christopher Columbus on his fourth and final voyage to the new world. His two ships, the Capitana and the Santiago sighted two small islands on May 10, 1503. These islands he called â€Å"Las Tortugas† because of their abundance of sea turtles, these islands eventually became Little Cayman and Cayman Brac. Columbus’ ships were off course when they sighted the islands and did not set foot on the islands. Columbus was an unintentional witness to the yearly gathering of sea turtles to mate and lay eggs. They were so abundant that their shells were mistaken for large rocks on the beaches. The turtles yearly migration was a large influence on the islands early history. Due to the lack of farm able land the Caymans were overlooked by the Spanish and became populated much later than many of the other Caribbean islands. Grand Cayman was not populated until the 1730's and Cayman Brac was not permanently settled until 1833. The first settlements were seasonal turtling outposts. The islands were a popular stop for passing pirates because of a few natural fresh water wells and the abundance of turtles and other animals that could be used for provisions. The low-lying Caymans have always been a challenge to ships navigating the region. All three islands have reefs surrounding the majority of their coasts, and the islands themselves being so low; they are very difficult for approaching ships to see, especially at night. The islands are also located on several popular shipping routes used from colonial times to today. Ships leaving Central America passed the Caymans on their way to the Gulf of Mexico and the strait of Florida, allowing the Gulf Stream to carry them out to the Atlantic. Large numbers of ships and dangerous reef lined islands is a recipe for shipwrecks and the Caymans have seen more than their fair share. Cayman Islands History :: Historical Cayman Island Essays Cayman Islands History Over the last five hundred years the Cayman Islands have had a rich and diverse history. They grew from being very isolated islands inhabited mostly by crocodiles and turtles to being one of the worlds premier tourist and financial centers. Being so small and isolated has given the Caymanians a strong sense of history and culture that is distinct, even from their Caribbean neighbors. They enjoyed a relative sense of insulation from many of the problems that plagued the rest of the region. The Caymans were â€Å"discovered† by the west by Christopher Columbus on his fourth and final voyage to the new world. His two ships, the Capitana and the Santiago sighted two small islands on May 10, 1503. These islands he called â€Å"Las Tortugas† because of their abundance of sea turtles, these islands eventually became Little Cayman and Cayman Brac. Columbus’ ships were off course when they sighted the islands and did not set foot on the islands. Columbus was an unintentional witness to the yearly gathering of sea turtles to mate and lay eggs. They were so abundant that their shells were mistaken for large rocks on the beaches. The turtles yearly migration was a large influence on the islands early history. Due to the lack of farm able land the Caymans were overlooked by the Spanish and became populated much later than many of the other Caribbean islands. Grand Cayman was not populated until the 1730's and Cayman Brac was not permanently settled until 1833. The first settlements were seasonal turtling outposts. The islands were a popular stop for passing pirates because of a few natural fresh water wells and the abundance of turtles and other animals that could be used for provisions. The low-lying Caymans have always been a challenge to ships navigating the region. All three islands have reefs surrounding the majority of their coasts, and the islands themselves being so low; they are very difficult for approaching ships to see, especially at night. The islands are also located on several popular shipping routes used from colonial times to today. Ships leaving Central America passed the Caymans on their way to the Gulf of Mexico and the strait of Florida, allowing the Gulf Stream to carry them out to the Atlantic. Large numbers of ships and dangerous reef lined islands is a recipe for shipwrecks and the Caymans have seen more than their fair share.

First Aid

INTRODUCTION First aid is the immediate assistance or treatment given to someone injured or suddenly taken ill before the arrival of an ambulance, doctor, or other appropriate qualified persons. It is a skill, based on knowledge, training and experience. First aid training is important as it is relevant at home, work place or industries and any other place. The term â€Å"FIRST AIDER† is usually applied to someone who has completed a theoretical and practical instruction course, and passed a professionally supervised examination. The standard first aid certificate awarded by St John Ambulance, St Andrews Ambulance Association and the British Red Cross is proof of all round competence. First aid must be administered as soon as possible. In case of critical injury, a few minutes can make the difference between complete recovery and loss of life. First aid requires rapid assessment of victims to determine whether life threatening conditions exists. First aid measures depend on the victims need and the provider’s level of knowledge and skill. Knowing what not to do in an emergency is as important as knowing what to do. DEFINITION OF TERMS FIRST AIDER: someone who has completed a theoretical and practical instruction course, and passed a professionally supervised examination. EMERGENCY: A serious, unexpected and potentially dangerous situation requiring immediate action or an unexpected event that must be dealt with urgently. CASUALTY: somebody who has a fatal accident, or receives a serious injury or suddenly falls ill. ACCIDENT: An unpleasant incident that happens unexpectedly. INCIDENT: An event, the occurrence of dangerous or exciting event. AMBULANCE: A vehicle for taking sick or injured people to and from hospital. HOSPITAL: An institution providing medical treatment and nursing care for sick or injured people. IMMOBILIZE: Prevent from moving or operating as normal. SIGN: What you see on the casualty. SYMPTOMS: What the casualty feels and tells you. FIRST AID DEFINITION: – immediate assistance or treatment given to an injured person or someone who suddenly falls ill before the arrival of an ambulance, doctor, or other appropriate qualified persons. It is also the first care given to a casualty or someone who suddenly falls ill before the arrival of a doctor or before taking the person to the hospital. AIMS AND OBJECTIVE OF FIRST AID †¢To save life. †¢To promote quick recovery. †¢To prevent the situation from getting worse †¢To save time. †¢To save cost. PRINCIPLES OF FIRST AID The golden rule is ‘’ first do no harm’’ while applying the principle of calculated risk. You should use treatment that is most likely to be beneficial to a casualty but do not use a doubtful treatment just for the sake of doing something. Assess the situation ?Observe what has happened quickly and calmly. ?Look for dangers to yourself and to the casualty. ?Never put yourself at risk. Make area safe. Protect the casualty from danger. ?Be aware of your limitations. Assess all casualties and give emergency aid ?Assess each casualty to determine treatment priorities, and treat those with life-threatening conditions first. Get help ?Quickly ensure that any necessary specialist has been summoned and is on the way QUALITIES OF A GOOD FIRST AIDER †¢Be resourc eful at all times. †¢Be sympathetic and empathetic to your casualty. †¢Be smart and confident. †¢Be observant. †¢Be bold. †¢Be gentle SCOPE OF FIRST AID This is the systematic way of administering first aid;- DIAGNOSIS:- †¢History Signs †¢Symptoms CARE:- This should be given in order of priority i. e. breathing, bleeding, burns and broken bones Transportation- Arrange to convey the casualty without delay to his home, suitable shelter, hospital and or summon a doctor in any serious case. EMERGENCY RESPONSE This is another procedure taken to ensure that appropriate first aid and safety is observed while assisting a casualty. When to use it depends on the situation you find yourself. D – Danger. R – Response (A. V. P. U. i. e. Alert, voice, pain, unresponsive). A – Airway. B –Breathing (L. L. F i. e. ook, listen and feel). C -circulation THE RESUSCITATION SEQUENCE To assess and treat a casualty who has collapse use the resu scitation techniques, obtained on the following pages. If breathing and pulse return at any points place the casualty in a recovery position. The resuscitation sequence Check response ? Open airway and check breathing ? Breathe for the casualty ? Assess for circulation ? commence CPR. CHECKING RESPONSE On discovering a casualty, you should first establish whether the casualty is conscious or unconscious. Ask a simple question such as ‘’hello can you hear me’’. ’What has happened to you’’. or give a command such as’’ open your eyes’’. Speak loudly and clearly, close to the casualty’s ear. OPEN THE AIRWAY An unconscious casualty’s airway may become narrowed or blocked. This makes breathing difficult and noisy or completely impossible. The main reason for this is that muscular control in the throat is lost, which allows the tongue to fall back and block the airway. Lifting the chin and tilting the head back lifts the tongue away from the entrance to the air passage, allowing the casualty to breathe. To open the airway – Place two fingers under the point of the casualty’s chin lift the jaw. At the same time, place your other hand on the casualty’s forehead and gently tilt the head well back. CHECKING BREATHING ?Kneel besides the casualty and put your face close to his mouth. ?Look, listen and feel for breathing. ?Look along the chest to see if the chest rises and falls, indicating breathing. ?Listen for sounds of breathing. ?Feel for breath on your cheek. ?Do these checks for up to ten seconds before deciding that breathing is absent. BREATHE FOR THE CASUALTY )Look into the mouth and remove any obvious obstruction including broken or displaced dentures from the mouth. Leave well fitted dentures in place. 2)Open the airway by tilting the head and using two fingers to lift the chin. 3)Close the casualty’s nose by pinching it with your index finger and thumbs. Take a full breathe and place your lips around his mouth, making a good seal. 4)Blow into your casualty’s mouth until you see the chest rise. Take about two seconds for full inflation. 5)Remove your lips and allow the chest to fall fully, which takes about four seconds. Repeat this once and then assess for signs of circulation. If pulse is absent and there are no sign of recovery such as any movement, swallowing, coughing or breathing, begin cardio pulmonary resuscitation. If breathing returns, place the casualty in the recovery position. ASSESSING FOR CIRCULATION Check the pulse for up to ten seconds, during which, look for other signs of recovery such as movement, breathing, swallowing and coughing. If you cannot find the pulse or there are no other signs of circulation, Begin chest compressions immediately. CARDIOPULMONARY RESUSCITATION (CPR) If there is no pulse, this means that the heart has stopped beating and you will have to provide an artificial circulation by means of chest compression. To be of any use, this process must always be combined with artificial ventilation. This procedure is known as Cardio-Pulmonary Resuscitation or CPR for short. If both you and your helper have been trained to administer C. P. R, you can do so together. GIVING CHEST COMPRESSIONS ?Kneel beside the casualty locate one of his lowermost ribs with the index and middle finger. Slide your finger along the ribs to the point where lowermost ribs meet at the breast bone. Place the heel of your other hand on the breast bone and slide it down until it reaches your index finger. This is the point at which you should apply pressure. ?Place the heel of your first hand on top of the other hand and inter lock your fingers. ?Leaning well over the casualty with your arms straight, press vertically down and depress the breast bone approximately 4-5cm, r elease the pressure without removing your hands. Compress the chest 30 times aiming for a rate of about 100 compressions per minute. Then give two artificial ventilations. Continue this cycle of alternating 30 chest compressions with two breaths of artificial ventilation until help arrives. CPR FOR A CHILD AND A BABY The same resuscitation sequence is applicable for a child but alternate five chest compressions with one breath of artificial ventilation. For one minute before calling an ambulance. Position your hand as you would for an adult but use heel of one hand only. For a baby under one year, place the tip of finger on the lower breast bone. Do this five times at a rate of 100 per minute Give one full breath of artificial ventilation, by breathing into the baby’s mouth and nose.

Instructional strategies exam essay Essay

Teachers are constantly challenged to ensure that teaching strategies employed in the classroom are appropriate the learning styles and experiences of the learners. As far as possible instructional strategies should be modified to take into consideration the unique characteristics of individual learners and aim to discover the best way forward when dealing with specific learning styles. Cooperative learning strategies are useful in teaching learners who function best in learning sessions that take into concern their individual needs, interests and abilities as well as provide opportunities for interaction and discussion with and among other learners. Constructivists have long established that learning cannot be separated from real-life experiences as both share a symbiotic relationship (Huang, 2002, p. 28). Bringing real-life situations into the learning environment will facilitate and enhance learning while knowledge, skills and attitudes gained in learning provide opportunities for additional life experiences. Cooperative learning strategies have a great amount of flexibility in the classroom and make it possible for the teacher to effectively match learning style to teaching strategy. Cooperative learning strategies are therefore quite attractive for adult learners as there is a multiplicity of activities and tasks that can be brought into any one learning experience to make learning not only effective but meaningful. These strategies are also useful in ensuring that learners have some amount of freedom and independence, as well as participate actively in their own learning. In a learning session using cooperative learning strategies individuals can be assigned to interest groups at the beginning of the session. Interest groups are individuals who may share either the same background or viewpoint. Interest groups are assigned either based on the particular task to be covered in the lesson or based on previously defined characteristics such as favorite type of food, music, TV shows etcetera. This is simply to ensure that all learners feel a sense of belonging by being able to identify with at least one other person in the group and therefore all will be motivated to actively participate in the lesson. Countless authors have pointed to the merits of using small groups as an effective teaching strategy to ensure participation and involvement (see Slavin, 2000). At the beginning of the lesson students are presented with the objectives and given precise guidelines of what they will be required to do throughout the lesson. Each group, that would have been identified previously, is given a particular aspect of the lesson to report or focus on and even within the group each member is assigned a specific responsibility and, of course, made aware how his/her role fits into the group task and the general lesson. In this way students will be accountable, not only for their own learning but also for the learning of the rest of the members who will be dependent upon him/her to correctly complete what is required. Kounin is famous for stressing this concept of accountability in learning. He also argues that it is essential to maintain the involvement of all students in all aspects of the lesson (as cited in Slavin, 2000, p. 373). Direct instruction often cannot be avoided in delivering lesson content depending on the material to be covered and may be essential in some cases. Thus in this setting direct instruction has its place but is supplemented with other strategies to ensure its effectiveness in meeting lesson objectives. To make a topic more meaningful and of immediate interest to the learners suggestions are gathered as to possible topics to explore, that can be aligned well with the overall curricular goals. By using the direct teaching method the teacher delivers the content to the entire class but each group is at that time paying particular attention to the aspect that is most relevant to the task they had been previously assigned. Visual aids and demonstrations, as appropriate, are used to enhance the impact of the lesson. A PowerPoint ® presentation would be particularly attractive to learners incorporating computer graphics, animation and even sound so that learners are able to interact with the lesson on a variety of levels. An alternative to the direct teacher or a supplemental to it would be to invite an outside speaker to deliver the specified topic. This guest speaker could be someone that the class nominates or someone that has expertise as well as being able to gain the interest and attention of the learners. Using either direct teaching, the PowerPoint ® or the guest speaker the group function is still maintained. At the end of these sessions groups meet to collaborate on completing the task assigned. In completing this task learners use problem solving skills to ensure that objectives are met. Working collaboratively group members have to explore alternatives for solving the problem or accomplishing the task that has been assigned. Included in the discussion is a decision on what aspect of the presentation is relevant or irrelevant to the task they have been assigned and the most appropriate way of organizing their work. They will also have to choose the most appropriate form in which to present their information. Each group is required, whether as a part of the session or in a subsequent session, to present their task to the rest of the class. As a part of the task description the teacher allows each group the flexibility of choosing whatever approach they feel will best be suited to presenting their information to the entire class. Role-play, simulation, demonstration, presentation or any other method could be adopted by the learners based on their individual preference. Alternatively all groups could role-play their particular scenario. Role-playing can be used to develop problem solving skills and to assess how much and how well learning has occurred. There is still a considerable amount of flexibility in that the groups use their own styles and ideas to come up with an appropriate situation to depict the problem they were assigned to. All members of the group will be required to roll-play ensuring that group activities are not manipulated by a specific set of learners and so that some learners do not opt out. Feedback of course, in any learning context is essential. Peer evaluation in this situation is useful. A discussion can ensue after each group role-plays or presents. Other classmates give feedback on the same issues and present possible alternatives to the solution that was taken or discuss why the option taken was the most appropriate for the particular issue at hand. Additionally comments relevant to the lesson could also be made. Learners in the small-group and large-group context are therefore able to cooperatively learn from each other by sharing ideas and making suggestions. Evidently learners are given a lot of independence within the specific guidelines and a lot of self-directed learning takes place. All these are essential for learners to make the most out of learning sessions and are preferable to techniques that are teacher-centered rather than learner-centered. In this way learners are actively participating in learning not just being passive listeners and observers. Throughout the lesson the teacher plays the role of facilitator or guide but the learners are the ones actively involved in the learning experiences and thus they would reap much more benefit. References Huang, H. (2002). Toward constructivism for adult learners in online learning environments. British Journal of Educational Technology, 33(1), 27-37. Slavin, R. E. (2000). Educational Psychology: Theory and Practice. (6th ed. ). Boston: Allyn and Bacon.

Disciples Are Created

â€Å"So God created man in his image. † Man was given dominion over all creation and paradise for his sustenance and enjoyment. But to whom much is given, much is likewise asked. The forbidden fruit from the Tree of Knowledge proved to be too difficult for Man to resist. That cost Man the loss of his paradise and banishment from heaven, in complete shame. He had truly fallen. God sent his Only Son to redeem Man. Jesus walked the earth and preached about God. From fishermen to a tax collector, Jesus created his own, chosen set of disciples.He said, â€Å"I did not come to call the righteous but sinners. † He had instructed them to continue His work when He has gone back to the Father. â€Å"Go, therefore, and make disciples from all nations. † Jesus died on the cross for Man. Man had sinned but Jesus led Man back to the Father. He had set the example for Man to follow. True discipleship is following God’s example of never giving up on Man’s fallibil ity. It is helping Man to rise from iniquity and taking the righteous path.His followers had betrayed Him like Judas and denied Him like Peter, yet He had it in His heart to forgive. He proclaimed, â€Å"Truly, I say to you, every sin will be forgiven humankind †¦Ã¢â‚¬  Whatever one’s status in life is, he may be made into a disciple. Simon Peter and Andrew were fishermen and Matthew was a tax collector. A disciple made from God’s own image follows His example. God forgave sin against Him. So must the disciple. The positive influence of God’s example to my personal ministry is to accept sinners and give them the second chances they need.

Medea Greek Mythology Essay

When Medea decides to take matters in to her own hands, about punishing the people who have done wrong to her, she is accused of wanting not justice—vengeance. Because I am not a native of neither Corinth nor Colchis, I have my own view about her motives. However, I would agree with the Corinthian Women, Medea is seeking vengeance; not justice. Some people might argue that Medea is seeking justice. When in actuality, Medea wants vengeance. The opposition would say justice took place because the Gods allowed Medea the time to perform her various acts. Although these things happened Medea turned to vengeance when she took it upon herself to kill Creon and his daughter Creusa. Even the chorus, the â€Å"ideal spectators†, implies that Creon is a poor king when, after he banishes Medea, the First Corinthian Woman sympathizes, â€Å"I am of Corinth and I say that Corinth is not well ruled. †(1. 214-216). This quote gives us proof that Medea has some sort of reason to seek revenge on Creon. However she lets her hatred exceed its boundaries and allows herself to take the lives of the King of Corinth and its Princess all because they chose Jason over her. In addition, her actions all prove that she wants Jason to do more than pay for hurting her. She wants him to suffer at the fate of her own children. Her revenge was selfish. Medea involved the two things she knew would hurt Jason the most—her own children. According to the First Corinthian Woman, â€Å"It would be better for you, Medea if the earth opened her jaws and took you down into darkness. But one thing you will not do, for you cannot, you will not hurt your own children, though wrath like plague-boils aches, your mind in a fire-haze bites the purple apples of pain. No blood-lapping beast of the field, she-bear nor lioness, nor the lean wolf-bitch, hurts her own tender whelps; nor the yellow-eyed, seythe-beaked, and storm shouldered eagle that tears the lambs has ever made prey of the fruit of her own tree. †(2. 115-126). Keep in mind that the Corinthian Women are the conscious of Corinth. Through this quote the First Corinthian Women has stated that Medea could not harm her own children. She even gives examples of the most dangerous predators that don’t even harm their own young. This is evidence that Medea went beyond the state of justice; but she went well into the state of vengeance. Medea knew what she was doing and quite frankly she could care less about anything other than what she thought of what was seeking revenge on Jason. In conclusion, vengeance was sought by Medea. She went above the fact of teaching Jason a lesson; she even stated she hated Jason more than she loved her children. Answer this question is what Medea has done entertaining or morally instructive?

Leadership and Management Research Paper Example | Topics and Well Written Essays - 1250 words

Leadership and Management - Research Paper Example All the complaints, problems and official liabilities of the nursing department have to be sorted by the chief nursing officer. Chief nursing officer must possess appropriate leadership skills because of the challenging demands that exist in working environment on daily basis. There are grave issues that take place in the health facilities like nursing staff deficiencies, human errors, life losses and patient dilemmas. Chief nursing officer has to make sure that the workflow of the health facility remains smooth and sound (Hader, 2011). Chief nursing officers are kind of leaders that are responsible for creating a special kind of patient care culture at the workplace so that the nurses working under him can know the fact that their main duty is to serve the needy patients whole heartedly. If the culture is based on human services and care then there will be really less issues and depleted problems. As a leader the chief nursing officers has to lead the nursing team and set examples. Chief nursing officer is responsible for creating cultures that support acts of courage and bravery in nursing. The American Organization of Nurse Executives has given a code of conduct to develop a good and groomed culture at the health care facilities (American Nurses Association, 2001). ... If the chief nursing officer will not show courage to take necessary and bold action, then there is a huge probability that the health care facility will not remain reliable in the eyes of the masses and overall organizational requirements of the hospital or health care facility will never be achieved. Corley (2002) described the ‘courage to take action’ in a morally declined society and stressful environments like that of any hospital as the most important factor in leading any health care environment. The nurses are normally over worked and inter-departmental conflicts occur on regular basis. CNO should be courageous enough to speak on behalf of the nurses and tell the upper hierarchies about the real needs of patients. Buresh and Gordon (2006) have argued that nurses must feel that the chief nursing officer is really working on their behalf and their voice is getting the appropriate outlet. Courage, conviction, and capacity to work in an adaptive way are the must have qualities of the chief nursing officers Chief nursing officers have the sole responsibility to make sure that patient care standards, clinical requirements and health standards are met at the health facility. He is accountable for any type of problems in the nursing department. Chief nursing officer has the duty to motivate, train and control the nursing staff and inculcate the fact in them that their main duty is to serve the patients. Any type of human error resulting in loss of human life or injury can cause detrimental effects to the health organization or hospital. The chief nursing officer just cannot issue orders and do nothing rather leadership and managerial

Antitrust Practices and Market Power Essay Example | Topics and Well Written Essays - 500 words - 1

Antitrust Practices and Market Power - Essay Example The antitrust investigation against Google by Federal Trade Commission (FTC) followed complaints from competing search engines. They claimed that Google had monopolized the search business and online advertising, making it difficult for them to compete. Other search engine claimed that Google had made it hard for new entrants to find their way into the markets and industries that Google had already established operations. The Federal Trade Commission, which prohibits unfair methods of competition and deceptive practices (Areeda & Hovenkamp, 2011), came in to investigate Google’s antitrust behavior. Although FTC finally closed the investigation against Google without filling any lawsuits, antitrust behavior comes at a cost to the company. Google had to prove its case that it was not engaging in antitrust practices. This drew company resources into the investigation, resources that could have been directed to other company developments. Most importantly, unfair and illegal business activities often taint company image and consumer loyalty. This could eventually mark a devastating turning point for the company. Investigation into Google’s antitrust behavior was undertaken within the relevant legal framework. The applicable legal provisions included the Sherman Act (1890), Clayton Act (1914), and Federal Trade Commission Act (1914) (Posner, 2001). Under the Sherman Act, Google was investigated for the monopolization claims by other search engines. In the light of Clayton Act, the company’s exclusive dealings were put on the spot. Finally, the FTC Act encompasses unfair and anticompetitive practices for which Google was being investigated. Perfect competition, monopoly, and oligopoly market structures influence competition differently (Federico, 2009). These market structures determine whether or not there are barriers to entry into any given market

The Importance of the Physician in the Generic and Trade-name Article

The Importance of the Physician in the Generic and Trade-name Prescription Decision - Article Example The time frame and period analyzed in the whole article ranges between 1984 and 1996. This is evident during the introduction of generics in 1984, when all firms that wanted to market, a post-patent expiration generic had to show the efficacy and safety of the drug through tests to the Food and Drug Administration. In the course of time, the Congress implemented the permissive substitution laws in an effort to encourage the use of generic drugs. In addition, the research shows that in 1996, information from IMS America Inc. showed that managed care payments such as private managed care as HMOS AND Medicaid HMOs amounted for over 505 of dollar revenues for pharmaceutical retail sales (Hellerstein, 109). The data sources used in the analysis involve information from a survey of physicians, their patients, and drugs prescribed. In this case, physicians use patient by patient basis to test whether physicians prescribe generics to patients who are not covered by insurance and the effects of state legislation on generic prescription (Hellerstein, 109). The main findings of the whole research show that physicians are important agents in prescription decisions. Therefore, identifying the sources of heterogeneity in behavior across physicians is an integral factor of understanding how the markets for prescription drugs operate. Individuals learn how physicians behavior whenever they have different information and incentives in the areas of specialization. The new information learned from the article indicates that changes are still occurring among physicians through the continued growth of managed care due to increase in market share of generic drugs. At the same time, there probabilities that emphasis on cost containment in Health Maintenance Organizations may cause price differential between a trade name and generic drugs since there are existing negotiations with manufacturers on price discounts.

Soft processor Research Paper Example | Topics and Well Written Essays - 2250 words

Soft processor - Research Paper Example This is important because laymen and some scholars often confuse them with each other in terms of their design and functionality. At the end of this paper, I intend to have achieved two main objectives: examine and discuss all aspects of soft core processors, and show a clear distinction (in terms of design and functionality) between soft core and hard core processors. Key words Core processors, soft core processors, hard core processors Introduction A soft processor is a patented core that is based on the Field-Programmable Gate Array (FPGA) logic primitives (Chu 2012, pg. 31). A hard processor, on the other hand, is a patented core that is based developed from dedicated silicon. In this regard, it is built directly onto non-reconfigurable silicon. A real example of a soft-processor is the Xilinx MicroBlaze processor core. This is a 32-bit processor core that is also a Reduced Instruction Set Computer (RISC). It has the following features: Harvard bus architecture Highly configurabl e cache Exceptional handling capacity and two levels of interruption A standardized core connect bus interface manufactured by IBM 3-stage pipeline Thirty-two registers for general purpose This processor can operate at up to 250MHz based on a Virtex-4 (4VLX40-12) component. Between 1000 and 2700 Xilinx LUTs (Look-Up tables) are required for the implementation of a MicroBlaze soft processor, depending on the manner in which the processor is configured. Background FPGA (Field Programmable Gate Array) An FPGA is an integrated circuit (IC) that is capable of being programmed to perform any logical function. FPGAs usually have many gates (sometimes even millions) which can be interlinked in any configuration required to resemble a logic circuit. Such interconnections are performed entirely using software. This is done by uploading a modified hardware definition for a logic circuit) to an FPGA. The FPGA will subsequently assume the attributes of that logic unit. The logic unit is defined using a HDL (hardware definition language). An FPGA is made up of a complex matrix/assembly of logic cells (Yiannacouras 2005, pg. 36). The FPGA is a general-purpose component that is full of digital logic building units. The two dominant firms in the FPGA industry are Xilinx and Altera. The most primitive building block used in FPGA is known as an LE (Logic Element) by Altera or an LC (Logic Cell) by Xilinx. In both cases, the building block is made up of an LUT for logical purposes and a flip-flop for purposes of storage. Apart from the LE/LC block, FPGAs also include clock management, multiplication blocks, memory, and input/output (I/O). LE/LC is often used in finding system costs. FPGAs offer hardware designers great flexibility. Although pioneer designers primarily employed FPGAs in debugging and prototyping, most commercial end-products now integrate FPGAs. Designers who use FPGAs are able to develop hardware components or entire systems quickly while still balancing the debu gging and prototyping benefits that FPGAs have over application-specific integrated circuit (ASIC) designs (Iniewski 2013, pg. 35). Constant increases in FPGA architectural features, performance, and capacity are allowing more designs to be implemented through FPGAs. To further this, FPGAs costs are declining, enabling designers to integrate FPGAs with 1 million similar gates for less than $13.